Nucleic Acids

Hi there, could anyone please tell me how I can connect two rna strands together via a known linker  that I don't have a structure for ?

Supposedly: RNA 1 is uaugaaaaua

RNA2 is cggcgaaagccg

and their linker is uuu

making a total of :

uaugaaaauauuucggcgaaagccg

How can i do this via rna_denovo?

Thanks in advance for any help!

I am getting the following error while trying to assemble a 514-nucleotide long RNA using the "Stepwise" programme:

"one of your input pdbs -- native, alignment, or starting -- has a residue that is not found in the fasta!"

I have thoroughly checked my target fasta sequence  and the input PDB containing part of the RNA structure. There are no residue mismatches...then why am I getting this error?

Hello, 
I'm using the rosetta rna de novo tool to generate a rna hairpin, I used the RNA_Denovo_with_base_pair_steps demo as a guide to do it, however I get the error: Atom C1' 1 not found. I' m newbie using rosetta so I would really appreciate any help or guide about the problem. Thank you!

Hello all, I had a question about how to properly use the -secstruct_general flag to input non-canonical and canonical basepairing interactions. I'm trying to test this on a simple structure from the 3IRW RNA that has a non-canonical g a basepair but I keep reseiving errors.  I am running the following command with the following files.

rna_denovo.static.linuxgccrelease -nstruct 1 -fasta ../test.fasta -secstruct_file ../test.secstruct -secstruct_general ../test.secgen -minimize_rna true -out:file:silent testing.out