You are here

Nucleic Acids

connecting rna strands together

Category: 
Nucleic Acids

Hi there, could anyone please tell me how I can connect two rna strands together via a known linker  that I don't have a structure for ?

Supposedly: RNA 1 is uaugaaaaua

RNA2 is cggcgaaagccg

and their linker is uuu

making a total of :

uaugaaaauauuucggcgaaagccg

How can i do this via rna_denovo?

 

Thanks in advance for any help!

 

Post Situation: 

building a protein-dna homology model via cm_rosetta

Category: 
Nucleic Acids

Hello everyone, recently I've been trying to make a homology model with a protein chain along with a nucleotide chain within it based on an existing template, but .

post-partial threading Rosetta dislocates the nucleotides nearly 1000 angstrom away from the structure. .

Post Situation: 

Stepwise error

Category: 
Nucleic Acids

I am getting the following error while trying to assemble a 514-nucleotide long RNA using the "Stepwise" programme:

"one of your input pdbs -- native, alignment, or starting -- has a residue that is not found in the fasta!"

I have thoroughly checked my target fasta sequence  and the input PDB containing part of the RNA structure. There are no residue mismatches...then why am I getting this error?

Post Situation: 

duplex RNA

Category: 
Nucleic Acids

Hello,

I am using FARFAR to get the possible structures for a A-bulge RNA duplex with the following specifications:

Input sequence: CCGGCAGUGUG+CACACGUCGG

Input secstruct (((((.(((((+))))))))))

I need to keep the structure in the duplex form and not the hairpin. All output files I got with the mentioned specifications are RNA hairpins. Is there a way I can keep the structure in the duplex form.

 

thanks for yoyr help.

Best,

Amir

 

 

Post Situation: 

de novo RNA loop

Category: 
Nucleic Acids

Hello, 
I'm using the rosetta rna de novo tool to generate a rna hairpin, I used the RNA_Denovo_with_base_pair_steps demo as a guide to do it, however I get the error: Atom C1' 1 not found. I' m newbie using rosetta so I would really appreciate any help or guide about the problem. Thank you!

Post Situation: 

rna_denovo secstruct_general function

Category: 
Nucleic Acids

Hello all, I had a question about how to properly use the -secstruct_general flag to input non-canonical and canonical basepairing interactions. I'm trying to test this on a simple structure from the 3IRW RNA that has a non-canonical g a basepair but I keep reseiving errors.  I am running the following command with the following files.

 

rna_denovo.static.linuxgccrelease -nstruct 1 -fasta ../test.fasta -secstruct_file ../test.secstruct -secstruct_general ../test.secgen -minimize_rna true -out:file:silent testing.out 

Post Situation: 

error running "helix_preassemble_setup.py"

Category: 
Nucleic Acids

Dear Rosetta users,

I recently install Rosetta and want to work with Rna_Denovo, when I run the command line below I got this error:

------------------------------------------------------------------------------------------------------------------------------------------------

Post Situation: 

Modelling temperature dependent RNA structures

Category: 
Structure prediction
Nucleic Acids

Hi to all,

I am really new to rosetta. I am using rna_denovo to generate 3D structures of RNA. I believe the default tempertaure used for modelling is 300K. I want to know if we can set our own temperature  for modelling RNA ? I did saw the option of temperature in the -help, written as 2 in the settings option, but I am not sure how to use it. Can we just define the temperature that we want, after writing this option? I am not sure how to go about this.

Please let me know the best way to go about this. And many thanks.

Post Situation: 

Rna Denovo

Category: 
Nucleic Acids

Dear all,

Im using RNA Denovo rosetta protocol to build a 3D model of a small RNA segment (~10 nucleotides). For a specific purpose, i would like to model a ensemble of this ssRNA segment avoiding base pairing. I tried to modify some parameters but the ssRNA built is always packaged, with some base pairs. Is it possible to model such ssRNA using Rna Denovo protocol? 

 

Thanks in advance for any help!

Post Situation: 

Pages

Subscribe to RSS - Nucleic Acids