You are here

Nucleic Acids

Deciding -nstruct for RNA FARFAR2

Category: 
Nucleic Acids

Hi,

I want to run FARFAR2 MPI protocol to build 3D model of 70 nt long RNA with command:

mpiexec -np 8 ${rna_denovo_mpi} -fasta seq.fasta -secstruct_file rna.secstruct -minimize_rna true -cycles 20000 -nstruct 5000 -fragment_homology_rmsd 1.2 -exclusion_match_type MATCH_YR -out:file:silent $outfile_name  > out.log

I am looking for suggestion about two parts:

1. How to decide optimal value for nstruct? I understand it could depend on RNA length, is there any thumb rule to decide -nstruct option?

Post Situation: 

FARFAR2 Error With Secondary Structure File

Category: 
Nucleic Acids

Any help with the following error? Thank you

--------------------------------------------------------------------

[FILE]: src/core/pose/rna/RNA_SecStruct.cc
[LINE]: 139
[START_MESSAGE]
[ ERROR ] UtilityExitException
ERROR: Number of right brackets does not match left brackets

 

[END_MESSAGE]
[END_CRASH_REPORT]

Post Situation: 

ValueError("Path %s does not exist!" % path_name) for rna_helix.py

Category: 
Structure prediction
Nucleic Acids

Hi everyone,

I want to model helices with rna_helix.py but I get an error that rna_helix.linuxgccrelease isn't in the path where python script is looking for it:

File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/bin/rna_helix.py", line 27, in <module>

Post Situation: 

Silent File Scores Missing: RNA Protein Complex Predition

Category: 
Nucleic Acids

Dear Community,

I am relatively unexperienced with Rosetta and am for the first time trying to run the Protein RNA Complex Prediction Tutorial, as described on the website and the readme file using the latest weekly Ubuntu release. So apologies if I did a newcomer mistake.

When running as described, I get an error that I need to add the option base bair steps to false, so I added

-bps_moves false

Post Situation: 

Comparing a prediction to the native structure and calculate RMSD for RNA

Category: 
Nucleic Acids

Hi all,

I am new to Rosetta and FARFAR2. I have attempted modelling the structure of PDB:1KXK using the following command line:

rna_denovo -sequence gucuaccuaucgggcuaaggagccguaugcgaugaaagucgcacguacgguucuaugcccgggggaaaac -cycles 20000 -nstruct 3 -bps_moves false -minimize_rna true -secstruct ".....(((.((((((...(((((((((((((((....))))))..)))))))))..)))))))))....."

Now I want to compare the obtained structure to the original PDB and to calculate the RMSD. I ran the following:

Post Situation: 

FARFAR2 - Extra Minimize Hangs on Submittal

Category: 
Nucleic Acids

Hello,

I have attempted several times to start a new FARFAR2 run that uses one or two template PDBs for homology modeling. This seems to work well with default settings, but I need to supply data in the "Residues for 'extra' minimization" text field to relax the homology model near its endpoints.  When I include data in this field, it causes the popup "Submitting FARFAR2 job..." to display indefinitely. I waited overnight to see if this was just slowing things down quite a bit, but no success. 

Post Situation: 

RNA update library

Category: 
Nucleic Acids

Hi,

I'm building RNA structures of 4kb using rna_denovo. For some of my structures I have this error message: 

ERROR: hey update AtomLevelDomainMap & RNA_ChunkLibrary to not use magic numbers like 999 and 1000

ERROR:: Exit from: src/core/import_pose/libraries/RNA_ChunkLibrary.cc line: 551

protocols.jd2.JobDistributor: [ ERROR ]

[ERROR] Exception caught by JobDistributor for job S_000001

[ ERROR ]: Caught exception:

File: src/core/import_pose/libraries/RNA_ChunkLibrary.cc:551

Post Situation: 

connecting rna strands together

Category: 
Nucleic Acids

Hi there, could anyone please tell me how I can connect two rna strands together via a known linker  that I don't have a structure for ?

Supposedly: RNA 1 is uaugaaaaua

RNA2 is cggcgaaagccg

and their linker is uuu

making a total of :

uaugaaaauauuucggcgaaagccg

How can i do this via rna_denovo?

 

Thanks in advance for any help!

 

Post Situation: 

Pages

Subscribe to RSS - Nucleic Acids