You are here

Home

Nucleic Acids

FARFAR2 Error With Secondary Structure File

Submitted by bdh81 on Thu, 2023-11-02 09:01
Category: 
Nucleic Acids

Any help with the following error? Thank you

--------------------------------------------------------------------

[FILE]: src/core/pose/rna/RNA_SecStruct.cc
[LINE]: 139
[START_MESSAGE]
[ ERROR ] UtilityExitException
ERROR: Number of right brackets does not match left brackets

 

[END_MESSAGE]
[END_CRASH_REPORT]

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - General

ValueError("Path %s does not exist!" % path_name) for rna_helix.py

Submitted by kameisel on Wed, 2023-08-16 00:39
Category: 
Structure prediction
Nucleic Acids

Hi everyone,

I want to model helices with rna_helix.py but I get an error that rna_helix.linuxgccrelease isn't in the path where python script is looking for it:

File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/bin/rna_helix.py", line 27, in <module>

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - Applications

Silent File Scores Missing: RNA Protein Complex Predition

Submitted by axio23 on Fri, 2023-06-16 05:45
Category: 
Nucleic Acids

Dear Community,

I am relatively unexperienced with Rosetta and am for the first time trying to run the Protein RNA Complex Prediction Tutorial, as described on the website and the readme file using the latest weekly Ubuntu release. So apologies if I did a newcomer mistake.

When running as described, I get an error that I need to add the option base bair steps to false, so I added

-bps_moves false

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - Applications

Comparing a prediction to the native structure and calculate RMSD for RNA

Submitted by danwolf_33 on Thu, 2023-02-09 09:32
Category: 
Nucleic Acids

Hi all,

I am new to Rosetta and FARFAR2. I have attempted modelling the structure of PDB:1KXK using the following command line:

rna_denovo -sequence gucuaccuaucgggcuaaggagccguaugcgaugaaagucgcacguacgguucuaugcccgggggaaaac -cycles 20000 -nstruct 3 -bps_moves false -minimize_rna true -secstruct ".....(((.((((((...(((((((((((((((....))))))..)))))))))..)))))))))....."

Now I want to compare the obtained structure to the original PDB and to calculate the RMSD. I ran the following:

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - Applications

FARFAR2 - Extra Minimize Hangs on Submittal

Submitted by jvogt on Thu, 2022-06-16 09:41
Category: 
Nucleic Acids

Hello,

I have attempted several times to start a new FARFAR2 run that uses one or two template PDBs for homology modeling. This seems to work well with default settings, but I need to supply data in the "Residues for 'extra' minimization" text field to relax the homology model near its endpoints.  When I include data in this field, it causes the popup "Submitting FARFAR2 job..." to display indefinitely. I waited overnight to see if this was just slowing things down quite a bit, but no success. 

Post Situation: 
Unsolved
Forums: 
ROSIE - General

RNA update library

Submitted by Anne Klein on Mon, 2022-05-16 16:04
Category: 
Nucleic Acids

Hi,

I'm building RNA structures of 4kb using rna_denovo. For some of my structures I have this error message: 

ERROR: hey update AtomLevelDomainMap & RNA_ChunkLibrary to not use magic numbers like 999 and 1000

ERROR:: Exit from: src/core/import_pose/libraries/RNA_ChunkLibrary.cc line: 551

protocols.jd2.JobDistributor: [ ERROR ]

[ERROR] Exception caught by JobDistributor for job S_000001

[ ERROR ]: Caught exception:

File: src/core/import_pose/libraries/RNA_ChunkLibrary.cc:551

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - General

connecting rna strands together

Submitted by y_atsmonraz on Tue, 2021-11-09 05:42
Category: 
Nucleic Acids

Hi there, could anyone please tell me how I can connect two rna strands together via a known linker  that I don't have a structure for ?

Supposedly: RNA 1 is uaugaaaaua

RNA2 is cggcgaaagccg

and their linker is uuu

making a total of :

uaugaaaauauuucggcgaaagccg

How can i do this via rna_denovo?

 

Thanks in advance for any help!

 

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - Applications

building a protein-dna homology model via cm_rosetta

Submitted by y_atsmonraz on Wed, 2021-10-20 23:11
Category: 
Nucleic Acids

Hello everyone, recently I've been trying to make a homology model with a protein chain along with a nucleotide chain within it based on an existing template, but .

post-partial threading Rosetta dislocates the nucleotides nearly 1000 angstrom away from the structure. .

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - Applications

Stepwise error

Submitted by debostuti on Wed, 2021-10-06 08:57
Category: 
Nucleic Acids

I am getting the following error while trying to assemble a 514-nucleotide long RNA using the "Stepwise" programme:

"one of your input pdbs -- native, alignment, or starting -- has a residue that is not found in the fasta!"

I have thoroughly checked my target fasta sequence  and the input PDB containing part of the RNA structure. There are no residue mismatches...then why am I getting this error?

Post Situation: 
Unsolved
Forums: 
ROSIE - General

Pages

Subscribe to RSS - Nucleic Acids