Hi all,
I am new to Rosetta and FARFAR2. I have attempted modelling the structure of PDB:1KXK using the following command line:
rna_denovo -sequence gucuaccuaucgggcuaaggagccguaugcgaugaaagucgcacguacgguucuaugcccgggggaaaac -cycles 20000 -nstruct 3 -bps_moves false -minimize_rna true -secstruct ".....(((.((((((...(((((((((((((((....))))))..)))))))))..)))))))))....."
Now I want to compare the obtained structure to the original PDB and to calculate the RMSD. I ran the following:
rna_score -just_calc_rmsd -in:file:silent default.out -out:file:silent comparison.txt -native 1kxk.pdb
However I get the following error:
ERROR: Pose and native are different lengths. If you want, pass -dihedral_rms false
ERROR:: Exit from: src/apps/public/rna/util/rna_score.cc line: 226
protocols.jd2.JobDistributor: [ ERROR ]
[ERROR] Exception caught by JobDistributor for job S_000002_0001
[ ERROR ]: Caught exception:
File: src/apps/public/rna/util/rna_score.cc:226
[ ERROR ] UtilityExitException
ERROR: Pose and native are different lengths. If you want, pass -dihedral_rms false
If I add the "-dihedral_rms false" parameter the error seems to be gone, but I do not understand why and what does that parameter do. So, my questions:
1) Why does the output structure have 1 missing atom as compared to the native one (1496 vs. 1497)?
2) Why does adding the -dihedral_rms false parameter "solve"?
3) How can I generate a figure of the structures superimposed?
4) Is there a good manual/resource to refer to, to understand the meaning of the different parameters and analysis options of rna_denovo?
Thank you all for your kind help!
Best,
Daniel